Telomere Guide, Meaning , Facts, Information and Description
A telomere is a region of highly repetitive DNA at the end of a chromosome, which functions as an aglet. Every time linear eukaryotic chromosomes are replicated, the DNA polymerase complex stops several hundred bases before the end; if it were not for telomeres, this would quickly result in the loss of useful genetic information. In prokaryotes, chromosomes are circular and thus do not have ends to suffer premature replication termination at. Only eukaryotes possess or require telomeres.Telomeres are extended by telomerases, specialized reverse transcriptases that are involved in synthesis of telomeres in most organisms. Telomerases are very interesting DNA polymerasess in that they carry an RNA template for the telomere sequence within them.
In humans, the telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but are generally GC-rich.
In most multicellular eukaryotes, telomerase is only active in germ cells. There are theories that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions. These theories remain relatively controversial at this time.
If telomeres become too short, they will uncap. The cell will detect this as DNA damage and will enter cellular senescence (growth arrest). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.
Advocates of human life extension promote the idea of lengthening the telomeres in certain cells through gene therapy. They reason that this would extend human life. So far these ideas have not been proven.
In 2003, scientists observed that the telomeres of the long-lived bird species Leach's storm petrel (Oceanodroma leucorhoa) seem to lengthen with age. This is considered the first known instance of such behaviour of telomeres.
Significant discoveries were made by the team led by Professor Liz Blackburn at the University of California - San Fransisco.
| Group | Organism | Telomeric repeat (5' to 3' toward the end) |
|---|---|---|
| Vertebrates | Human, mouse, Xenopus | TTAGGG |
| Filamentous fungii | Neurospora crassa | TTAGGG |
| Slime moulds | Physarum, Didymium Dictyostelium | TTAGGG AG(1-8) |
| Kinetoplastid protozoa | Trypanosoma, Crithidia | TTAGGG |
| Ciliate protozoa | Tetrahymena, Glaucoma Paramecium Oxytricha, Stylonychia, Euplotes | TTGGGG TTGGG(T/G) TTTTGGGG |
| Apicomplexan protozoa | Plasmodium | TTAGGG(T/C) |
| Higher plants | Arabidopsis thaliana | TTTAGGG |
| Green algae | Chlamydomonas | TTTTAGGG |
| Insects | Bombyx mori | TTAGG |
| Roundworms | Ascaris lumbricoides | TTAGGC |
| Fission yeasts | Schizosaccharomyces pombe | TTAC(A)(C)G(1-8) |
| Budding yeasts | Saccharomyces cerevisiae Candida glabrata Candida albicans Candida tropicalis Candida maltosa Candida guillermondii Candida pseudotropicalis Kluyveromyces lactis | TGTGGGTGTGGTG (from RNA template) or G(2-3)(TG)(1-6)T (consensus) GGGGTCTGGGTGCTG GGTGTACGGATGTCTAACTTCTT GGTGTA[C/A]GGATGTCACGATCATT GGTGTACGGATGCAGACTCGCTT GGTGTAC GGTGTACGGATTTGATTAGTTATGT GGTGTACGGATTTGATTAGGTATGT |
